Anti-primer quenching-based real-time PCR for simplex or multiplex DNA quantification and single-nucleotide polymorphism genotyping | Nature Protocols
Table S1. Sequence of primers used in real-time PCR Forward Primer Reverse Primer Human IL1β AGCTACGAATCTCCGACCAC CGTTATCCCATG
Multiplex real-time PCR using double-strand primers and probes for the detection of nucleic acids - Analytical Methods (RSC Publishing)
Options for quantitative analysis by real-time PCR - European Pharmaceutical Review
Real-time PCR based on SYBR-Green I fluorescence: An alternative to the TaqMan assay for a relative quantification of gene rearrangements, gene amplifications and micro gene deletions | BMC Biotechnology | Full Text
AlleleID: Real-Time PCR Assay Design Software for Pathogen Detection and Bacterial Identification
Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR | Experimental & Molecular Medicine
Quantitative PCR Basics
Basic Principles of RT-qPCR | Thermo Fisher Scientific - US
Glen Report 21.11 - HOT START PCR update: CleanAmp™ Primers
Gene Quantification & optimisation real-time / kinetic PCR / RT-PCR reactions
Primers with 5′ flaps improve real-time PCR | BioTechniques
Optimization of primer sets and detection protocols for SARS-CoV-2 of coronavirus disease 2019 (COVID-19) using PCR and real-time PCR | Experimental & Molecular Medicine
Real-Time qRT-PCR
Introduction to PCR Primer & Probe Chemistries | Bio-Rad
Real-time PCR probe optimization using design of experiments approach - ScienceDirect
Real-time PCR for mRNA quantitation | BioTechniques
Introduction to PCR Primer & Probe Chemistries | Bio-Rad
Real‐time PCR (qPCR) primer design using free online software - Thornton - 2011 - Biochemistry and Molecular Biology Education - Wiley Online Library
PCR Amplification | An Introduction to PCR Methods | Promega
Influence of RT-qPCR Primer Position on EGFR Interference Efficacy in Lung Cancer Cells | Biological Procedures Online | Full Text
Introduction to PCR Primer & Probe Chemistries | Bio-Rad
Basic Principles of RT-qPCR | Thermo Fisher Scientific - US
